Shenmue Dojo

Posted: **Fri Oct 12, 2012 10:05 pm**

I just rewatched Vampire Hunter D.

I was convinced that it's not going to stand the test of time, but I only loved it more than ever. There was no better way to squeeze that novel material into a 80 minutes anime back then. A true classic in which I wouldn't change even one frame. I even like the ending music, though, so you can call me a drity fanboy. Just watch your neck...

Posted: **Sat Oct 13, 2012 12:05 am**

I might give it a try. Been looking for some good Halloween anime.

Posted: **Sat Oct 13, 2012 12:14 am**

I wish someone here other than me would watch Morbito. Honestly one of the best I ever seen.

Posted: **Sat Oct 13, 2012 12:30 am**

KiBa wrote: I might give it a try. Been looking for some good Halloween anime.

Bloodlust is vastly superior, but the original one has the '80s spirit nailed down and I love it.

Posted: **Sat Oct 13, 2012 1:10 am**

^ Good to know.

Bluecast wrote: I wish someone here other than me would watch Morbito. Honestly one of the best I ever seen.

I watch Moribito. It's great.

Posted: **Sun Oct 14, 2012 7:46 am**

Just finished Anohana. It was pretty good, had some really great characters but the show itself tried too hard to be sad.. it had its moments but overall it was just not very effective. It's worth watching just because of the characters though, you'll hate them all.... but then you'll love them! Hurray!

Anyway here's the opening, couldn't find it on youtube...

Posted: **Sun Oct 14, 2012 8:02 am**

Never heard of that show before. It looks good. Thanks for the post, LAMEWAD.

Posted: **Sun Oct 14, 2012 11:04 am**

None, I don't like anime.

Posted: **Sun Oct 14, 2012 6:19 pm**

Crayon Shinchan. One of the funniest anime out there.

Posted: **Mon Oct 15, 2012 6:17 am**

Now I'm moving onto Shin Megami Tensei: Tokyo Mokushiroku/Tokyo Revelation. Sweet stuff, but SMT fans should know that it's based on the SMT manga by Suzuki Kazunari and Ogishima Chiaki, a manga which is very loosely related to the games.

I'd like to go back to the Megami Tensei anime from the 80s, the one I talked about earlier.

It's actually pretty weak overall (too short and cheesy, and it was intended as a starting point for what never followed, lol), but there are some cool bits of it.

In an interesting twist of fate, Tony from Digital Devil Database managed to buy some cels from this anime!

Posted: **Sat Oct 27, 2012 2:55 am**

I just noticed for the first time something interesting in Cowboy Bebop, and I'm sure probably everyone noticed it but me, but for anyone who has finished it

Posted: **Sat Oct 27, 2012 2:05 pm**

Kibas avatar makes sense now.

Posted: **Thu Nov 08, 2012 10:52 pm**

I was sitting in the lab for my molecular biology class and the professor had written down an example of a DNA sequence of a certain allele. It went something like this:

CCCTCATTCATTCATTCATCA

In my sleep-deprived state of my mind, I read that as

ATATATATATATATATATATATAT

For the next five minutes I wondered what class would be like if Kenshiro taught it before realizing that I should probably be paying attention.

Posted: **Fri Nov 09, 2012 1:35 am**

Chances are, that's actually what Kenshiro's DNA sequences look like.
So much explained.

Posted: **Sun Nov 11, 2012 11:39 am**

Hyouka. The translation is horrible.

Shenmue Dojo

General Anime Discussion

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?

Re: What Anime are you watching right now?